Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of 946;-tubulin gene by using Real-Time PCR

Maria Helena Pelegrinelli Fungaro, Luis G. Morello, Daniele Sartori, André L.O. Martinez, Marta H.Taniwaki & Maria Lúcia C. Vieira

Author address: 

1Universidade Estadual de Londrina, Londrina, Brazil, 86051-990; 2Instituto de Tecnologia de Alimentos, Campinas, Brazil, 13070-178; 3Escola Superior de Agricultura Luiz de Queiroz, Piracicaba, Brazil, 13400-970

Abstract: 

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin named ochratoxin A (OA), which has been found in coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using Real-Time PCR. The primers Bt2Aw-F 5’TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5’CGGAAGCCTAAAAAATGAAGAG provided an amplicon in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.
2007

abstract No: 

FdBev 08

Full conference title: 

161st Society for General Microbiology
    • SGM 161st (2007)