Evaluation of the Bruker MALDI BioTyperTM 3 database for the identification of filamentous fungi compared with conventional identification and ITS rRNA genotyping

Ref ID: 19356

Author:

R. Gorton, C. Ozongwu, S. Akhtar, T.D. McHugh and
C. C. Kibbler

Author address:

Royal Free Hospital, London, United Kingdom and University
College London, Centre for Clinical Microbiology, United Kingdom

Full conference title:

6th Trends in Medical Mycology 2013

Date: 11 October 2014

Abstract:

Objectives Conventional methods for identifying filamentous fungi;
solid agar culture and macro/microscopic phenotypic analysis,
require training and expertise. Maintaining the skills necessary for
conventional fungal identification presents a challenge for microbiol-
ogy laboratories. The recent introduction of MALDI-TOF mass spec-
trometry (MS) platforms into the routine diagnostic setting has enabled bacterial and yeast identification in less than 15 minutes. In
a recent development the first Biotyper 3TM database for filamentous
fungi identification was released. This study aimed to evaluate the
database for the identification of clinically significant filamentous
fungi, compared with identifications obtained using conventional cul-
ture and microscopy and ’gold standard’ ITS rRNA genotyping.
Methods 139 isolates were selected at random from a collection of clin-
ical isolates. For conventional identification isolates were cultured on
Sabouraud (SAB) agar incubated at 30°C and 37°C. Lactophenol cotton
blue sellotape and needle mount preparations were analysed using light
microscopy by an experienced health care scientist. Laboratory keys
included Identification of Pathogenic Fungi2 and Atlas of Clinical Fungi3
ITS rRNA analysis included DNA extraction using mechanical lysis
and phenol/chloroform extraction methods. Conventional PCR was
performed using primers ITS1 (50 TCC GTA GGT GAA CCT GCG G
30) and ITS4 (50 TCC TCC GCT TAT TGA TAT GC 30) and ITS5
(GGAAGTAAAAGTCGTAACAAGG). Sequence analysis of amplicons
was performed using BigDye Terminator v3.1 Cycle Sequencing
method on an Applied Biosystems 3130 platform.
MALDI-TOF analysis included culture of isolates by inoculating
spores into SAB broth and incubation on a rotating platform at 30°C
for 24 hours. Fungal balls were extracted and subjected to standard
formic acid protein extraction. The resulting supernatant was used
for analysis. Analytes were overlaid with 1 ll a-Cyano-4-hydroxy-
cinnamic-acid matrix. Samples were analysed on a MicroflexTM LT
platform using Biotyper software (Bruker Daltonics) analysing spectra
in the 2000-20,000 m/z range standard settings. Bruker BiotyperTM
log score thresholds for secure species were set at >2.0.
Results The MALDI Biotyper identified 90% (125/139) of isolates.
When compared with ITS rRNA identifications the MALDI Biotyper
showed an overall agreement of 93.6% (117/125). 10% (14/139) of
MALDI-TOF analyses returned a result of ’no identification’ despite
obtaining good spectra. Conventional methods identified 98.5%
(137/139). When conventional identifications were compared with
ITS rRNA identification 86.9%% (119/137) agreement was achieved.
Conclusion The MALDI BioTyperTM 3 filamentous fungi database
contains >300 species. This study has demonstrated that identifica-
tions returned by the Biotyper 3 database for filamentous moulds are
not yet at the level of accuracy seen with bacterial and yeast analy-
ses but is at least as good as conventional methods. Further develop-
ment of the database may enable the use of MALDI-TOF for
filamentous mould identification within the routine setting in the
near future. MALDI-TOF MS alongside Bruker MALDI BioTyperTM 3
software has shown potential as a routine method for the identifica-
tion of filamentous fungi.

Abstract Number: o1.3

Conference Year: 2013

Link to conference website: NULL

New link: NULL

Conference abstracts, posters & presentations

Showing 10 posts of 17325 posts found.

  • Title

    Author

    Year

    Number

    Poster